|  Help  |  About  |  Contact Us

Allele : Carhsp1<em1(IMPC)J> calcium regulated heat stable protein 1; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7507543 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Carhsp1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTATGTCCACCACAGATGGT and ACAGAGCTTGAGACTCCTAG, which resulted in a 1108 bp deletion beginning at Chromosome 16 position 8,663,387 bp and ending after 8,664,494 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000129745 and ENSMUSE00000563877 (exons 2 and 3) and 797 bp of flanking intronic sequence including the splice acceptor and donor as well as start site and is predicted result in a null allele. There is a 9 bp insertion (TCACTCACA)at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele