| Primary Identifier | MGI:7491948 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cul3 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A single nucleotide (A) was inserted (after GRCm39:g.80264764A) into exon 6 using an sgRNAs (targeting GGATTAATGAGGAAATAGAG) and an ssODN template with CRISPR/Cas9 technology. This frameshift mutation was generated next to the site of the human p.E246* mutation associated with autism spectrum disorder (ASD). |
