|  Help  |  About  |  Contact Us

Allele : Cul3<em1Limi> cullin 3; endonuclease-mediated mutation 1, Lilia M Iakoucheva

Primary Identifier  MGI:7491948 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cul3
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  A single nucleotide (A) was inserted (after GRCm39:g.80264764A) into exon 6 using an sgRNAs (targeting GGATTAATGAGGAAATAGAG) and an ssODN template with CRISPR/Cas9 technology. This frameshift mutation was generated next to the site of the human p.E246* mutation associated with autism spectrum disorder (ASD).
  • mutations:
  • Insertion
  • synonyms:
  • Cul3<->,
  • Cul3<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele