| Primary Identifier | MGI:7520409 | Allele Type | Endonuclease-mediated |
| Gene | Wdr24 | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 155 (TCT) in exon 1 was changed to aspartic acid (GAT) (p.S155D) using an sgRNA (targeting GTGCTTTGACCTCCGAAGGAAGG and GACTCTGTCAGCACCTTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the affected residue in the encoded peptide to a phosphomimetic. |
