| Primary Identifier | MGI:7519190 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Hypomorph | Gene | Tmem161b |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Leucine codon 85 (CTA) in exon 4 was changed to arginine (CGA) (c.254T>G, p.L85R) using an sgRNA (targeting CAGACTTGGTTTCTAGATGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with polymicrogyria (PMG). |
