| Primary Identifier | MGI:7520092 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem161b |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Leucine codon 85 and tryptophan codon 317 were targeted for changing to arginine using sgRNAs (targeting CAGACTTGGTTTCTAGATGA and CATTTGATACTCTTCGACTC) and ssODN templates with CRISPR/Cas9 technology. This allele knockout allele, with an unspecified frameshifting genome sequence mutation, results from incorrect repair of the targeted sequence. |
