| Primary Identifier | MGI:7520348 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Slc25a32 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Tyrosine codon 174 (TAT) in exon 4 was changed to cysteine (TGT) (c.521A>G, p.Y174C) using an sgRNA (targeting TATAAATATGAAGGTGTGCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). |
