| Primary Identifier | MGI:7520349 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Slc25a32 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Lysine codon 235 (AAA) in exon 6 was changed to arginine (AGA) (c.704A>G, p.K235R) using an sgRNA (targeting ATACGGGTATGTTGCTGCTACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). |
