|  Help  |  About  |  Contact Us

Allele : Rnd3<em1Nses> Rho family GTPase 3; endonuclease-mediated mutation 1, Senad Sestan

Primary Identifier  MGI:7511886 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready Gene  Rnd3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Guide RNAs (ATCAGAGAGCTCCTATGCAT and TTTCCTCCAAAAAACGAACG) were designed to insert loxP sites flanking exon 3.
  • mutations:
  • Insertion
  • synonyms:
  • Rnd3<fl>,
  • Rnd3<fl>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele