| Primary Identifier | MGI:7512907 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gng12 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GTTGGTGCTTGCCGTCTTGC (within ENSMUSE00000256838) and CGGAGCGACCCCCTGCTGAT(within exon ENSMUSE00001368854). This resulted in a 1769bp deletion of Chr6 from 66992743 to 66994511 with insertion of A and a T>C at 66992738 (GRCm39), introducing a frameshift and premature stop codon. |
