| Primary Identifier | MGI:7514380 | Allele Type | Endonuclease-mediated |
| Gene | Mettl16 | Strain of Origin | (C57BL/6J x DBA/2J)F1/J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Phenylalanine codon 187 (TTT) in exon 5 was changed to glycine (GGC) (p.F187G) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation renders the encoded peptide catalytic-dead, losing its RNA methylation activity. |