| Primary Identifier | MGI:7514381 | Allele Type | Endonuclease-mediated |
| Gene | Mettl16 | Strain of Origin | (C57BL/6J x DBA/2J)F1/J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Proline codons 185 (CCT) and 186 (CCC) in exon 5 were changed to alanine (GCC and GCA) (p.P185_P186delinsAA) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation causes the encoded peptide to lose its RNA-binding activity. |
