| Primary Identifier | MGI:7541100 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Wwox |
| Strain of Origin | FVB/N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Proline codon 47 (CCG) in exon 2 was changed to threonine (ACC) (NM_019573.3:c.139_141delCCGinsACC, NP_062519.2:p.P47T) using an sgRNA (targeting CAGTGGGAACATCCGAAAACCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, located in the first WW domain of the encoded peptide, represents the same human mutation associated with autosomal recessive cerebellar ataxia with epilepsy and intellectual disability (SCAR12, MIM:614322). |
