| Primary Identifier | MGI:7522066 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Inserted expressed sequence, Reporter | Gene | Gt(ROSA)26Sor |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The targeting vector is constructed based on the Ai9 vector from Addgene with the DTA and neomycin sequences present in Ai9 removed. This targeting vector has a final size of 13.7kb, contains (from 5' to 3') a CAG (CMV enhancer/chicken beta-actin) promoter, an FRT site, a loxP-flanked STOP cassette (with stop codons in all 3 reading frames and a triple polyA signal), the Kaleidoscope construct (described in greater detail below), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), and a polyA signal. CRISPR/cas9 genome editing used gRNA (ACTCCAGTCTTTCTAGAAGA) with 2'-O-Methyl at 3 first and last bases and 3' phosphorothioate bonds between first 3 and last 2 bases. Kaleidoscope contains three fluorescent cell biology reporters separated by 2A self-cleaving sequences. From 5' to 3' it contains a rat lysosomal-associated membrane protein 1 (LAMP1) gene fused to an enhanced monomeric blue fluorescent protein (TagBFP) sequence, a P2A self-cleaving peptide, an N-terminal mitochondrial targeting pre-sequence (derived from human cytochrome c oxidase subunit VIII [COX8A]), fused to a far-red fluorescent protein (mKate2) a T2A self-cleaving peptide, and an enhanced green fluorescent protein sequence fused to human Tubulin Alpha 1c (TUBA1C) sequence. |
