|  Help  |  About  |  Contact Us

Allele : Polr1a<em2Knwea> polymerase (RNA) I polypeptide A; endonuclease-mediated mutation 2, Kathryn Nicole Weaver

Primary Identifier  MGI:7526142 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Polr1a
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 1635 (CCT) in exon 33 was changed to leucine (CTT) (c.4904C>T, p.P1635L) using an sgRNA (targeting GCCACCAGGGAGAGATGGCGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4913C>T (p.Pro1638Leu) mutation associated with craniofacial, neural, and cardiac anomalies.
  • mutations:
  • Single point mutation
  • synonyms:
  • Polr1a<P1635L>,
  • Polr1a<P1635L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele