| Primary Identifier | MGI:7520857 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clcc1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Lysine codon 298 in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was targeted for change to alanine using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG ) and an ssODN template with CRISPR/Cas9 technology. This allele is the result of incorrect repair, with the insertion or duplication of a C five nucleotides from the 3' end of the exon (GRCm39:chr3:108580229dup), resulting in a frameshift and a premature stop codon shortly thereafter. |
