| Primary Identifier | MGI:7526416 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Spata31 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCAGGCATTCTCCCCAAGC and GTTCTCTACAGACATCTCTC, which resulted in a 2729 bp deletion beginning at Chromosome 13 position 64,920,298 bp and ending after 64,923,026 bp (GRCm38/mm10). This mutation deletes 2729 bp from ENSMUSE00000448525 (exon 3) and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 3 amino acids later. |
