| Primary Identifier | MGI:7522806 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Del(11Gsdma3-Gsdma)1Cnlr |
| Strain of Origin | Not Specified | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology using the 5â gRNA TTTATGCATCCATCAAGGCT which cut 54 bp upstream of Gsdma3 exon 1 and the 3â gRNA TCGGAGTCATTCATCGGCCA which cut 156 bp downstream of Gsdma1 exon 12, deleted a region of approximately 52 kb that eliminates the coding sequence of all three genes Gsdma, Gsdma2, and Gsdma3 and includes no overlapping genes on either DNA strand. Sequencing confirmed knock-out of all three genes. |
