| Primary Identifier | MGI:7515015 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gask1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGCATTCTGCCTCTTGA and CCAAACGTGCCCACTCAGCA, which resulted in a 1160 bp deletion beginning at Chromosome 9 position 121,964,787 bp and ending after 121,965,946 bp (GRCm38/mm10). This mutation deletes 1160 bp from ENSMUSE00000633461 (exon 2) and is predicted to cause a change of amino acid sequence after residue 2 and early truncation 7 amino acids later. |
