| Primary Identifier | MGI:7543632 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Asxl3 |
| Strain of Origin | C57BL/6-Mib1<em1Jlp> | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Methionine codon 1361 (ATG) in exon 13 was changed to valine (GTC) (p.M1361V) using a crRNA (targeting TCGCCCATCGCAATGTTTGC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.M1415V mutant (SNPs rs181303838) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em1Jlp allele and created at the same time as the Apcdd1em1Jlp allele. |
