|  Help  |  About  |  Contact Us

Allele : Apcdd1<em1Jlp> adenomatosis polyposis coli down-regulated 1; endonuclease-mediated mutation 1, Jose de la Pompa

Primary Identifier  MGI:7543634 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Apcdd1
Strain of Origin  C57BL/6-Mib1<em1Jlp> Is Recombinase  false
Is Wild Type  false
molecularNote  Valine codon 150 (GTC) in exon 4 was changed to isoleucine (ATT) (p.V150I) using a crRNA (targeting CCTCTGTGTGGCAGATGACT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of human SNPs rs3748415 found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em1Jlp allele and created at the same time as the Asxl3em1Jlp allele.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Apcdd1<V150I>,
  • Apcdd1<V150I>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories