| Primary Identifier | MGI:7543678 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ncln |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CAGAGAGGGGCACAACAGTG and CACTTGGTGCCAGAGCCACA, which resulted in a 438 bp deletion beginning at Chromosome 10 position 81,490,901 bp and ending after 81,491,338 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000102265 (exon 6) and 334 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 232 and early truncation 22 amino acids later. |
