| Primary Identifier | MGI:7543448 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Mib1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Valine codon 943 (GTT) in exon 20 was changed to phenylalanine (TTT) (p.V943F) using an sgRNA (targeting CTGCACATCTGCGTTAACAT) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the same human mutation (c.2827G>T) found in some left ventricular noncompaction (LVNC) patients. |
