|  Help  |  About  |  Contact Us

Allele : Cep192<em1Jlp> centrosomal protein 192; endonuclease-mediated mutation 1, Jose de la Pompa

Primary Identifier  MGI:7543635 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Cep192
Strain of Origin  C57BL/6-Mib1<em2Jlp> Is Recombinase  false
Is Wild Type  false
molecularNote  Threonine codon 1522 (ACG) in exon 24 was changed to methionine (ATG) (p.T1522M) using a crRNA (targeting GGAAAACGTGAAACAGCGCC) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.T1547M mutant (SNPs rs143331552) found in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Tmx3em1Jlp allele.
  • mutations:
  • Single point mutation
  • synonyms:
  • Cep192<T1522M>,
  • Cep192<T1522M>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele