| Primary Identifier | MGI:7532617 | Allele Type | Endonuclease-mediated |
| Gene | Sall4 | Is Recombinase | false |
| Is Wild Type | false |
| description | E14Ju09 ES cell line |
| molecularNote | Threonine codon 919 (ACG) in exon 3 was changed to aspartic acid (GAT) (p.T919D) and asparagine codon 922 (AAC) in exon 3 to alanine (GCC) (p.N922A) using an sgRNA (targeting CGTGTGTAACATATGCGGGC) and an ssODN template with CRISPR/Cas9 technology. The mutations affect the AT-binding zinc finger in C2H2 zinc finger cluster 4 (ZFC4) of the encoded peptide. |