| Primary Identifier | MGI:7537145 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Slc38a9 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTAATAGTCAAGAGTCTCAC and GCCAGCAGGAGCTTAAGTTA, which resulted in a 1350 bp deletion beginning at Chromosome 13 position 112,689,111 bp and ending after 112,690,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000408687, ENSMUSE00000378819, ENSMUSE00000338903 (exons 4,5,6) and 1070 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 81 and early truncation 37 amino acids later. |
