|  Help  |  About  |  Contact Us

Allele : Cx3cr1<em1Ccg> C-X3-C motif chemokine receptor 1; endonuclease-mediated mutation 1, Christopher C Goodnow

Primary Identifier  MGI:7537040 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cx3cr1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 2 was targeted with an sgRNA (targeting TACGCCCTCGTCTTCACGTTCGG) using CRISPR/Cas9 technology, leading to a 1 bp deletion (GRCm39:chr9:g.119881268delA) that causes a frameshift and a premature stop codon (p.F45Sfs*28).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cx3cr1<KO>,
  • Cx3cr1<KO>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele