|  Help  |  About  |  Contact Us

Allele : Stat3<em2Ccg> signal transducer and activator of transcription 3; endonuclease-mediated mutation 2, Christopher C Goodnow

Primary Identifier  MGI:7537037 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Stat3
Strain of Origin  (C57BL/6J x FVB/N)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Lysine codon 658 (AAG) in exon 21 was changed to asparagine (AAC) (p.K658N) using an sgRNA (targeting CATGGATGCGACCAACATCCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SH2 domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL).
  • mutations:
  • Single point mutation
  • synonyms:
  • Stat3<K658N>,
  • Stat3<K658N>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele