| Primary Identifier | MGI:7537037 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Stat3 |
| Strain of Origin | (C57BL/6J x FVB/N)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Lysine codon 658 (AAG) in exon 21 was changed to asparagine (AAC) (p.K658N) using an sgRNA (targeting CATGGATGCGACCAACATCCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SH2 domain of the encoded peptide, is the equivalent of the same human gain-of-function (GOF) mutation associated with T cell large granular lymphocytic leukemia (T-LGL). |
