| Primary Identifier | MGI:7529755 | Allele Type | Endonuclease-mediated |
| Gene | Rptor | Strain of Origin | C57BL/6 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Serine codon 722 (TCC) in exon 19 was changed to alanine (GCT) (p.S722A) using an sgRNA (targeting TCCGTTCAGTGAGCTCCTATGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide to a phosphoblocker. This allele was created in mice that carry the Rptorem2Rjsh allele (p.S792A mutation). |
