|  Help  |  About  |  Contact Us

Allele : Tyr<em1Guof> tyrosinase; endonuclease-mediated mutation 1, Guoping Feng

Primary Identifier  MGI:7526756 Allele Type  Endonuclease-mediated
Gene  Tyr Is Recombinase  false
Is Wild Type  false
molecularNote  Cysteine codon 89 (TGC) was changed to serine (AGC) (p.C89S) using an sgRNA (targeting CCTGCCAGTGCTCAGGCAACTTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is associated with albinism.
  • mutations:
  • Single point mutation
  • synonyms:
  • Tyr<C89S>,
  • Tyr<C89S>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele