| Primary Identifier | MGI:7529483 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pik3r2 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Glycine codon 367 (GGG) in exon 10 was changed to arginine (AGG) (c.1099G>A, p.G367R) using an sgRNA (targeting TAATACGACTCACTATAGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.1117G>A (p.G373R) mutation associated with megalencephaly polymicrogyria polydactyly hydrocephalus (MPPH) syndrome. |
