|  Help  |  About  |  Contact Us

Allele : Gata3<em1Aben> GATA binding protein 3; endonuclease-mediated mutation 1, Albert Bendelac

Primary Identifier  MGI:7518200 Allele Type  Endonuclease-mediated
Attribute String  Reporter Gene  Gata3
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  CRISPR/cas9 genome editing used a guide crRNA [GGAGGAACTCTTCGCACACT] to insert an internal ribosomal entry site (IRES)/citrine yellow fluorescent sequence into the 3' UTR of the gene. Gata3 transcript Gata3-201 (ENSMUST00000102976.4) was used as reference for for the exon number and guide sequences
  • mutations:
  • Insertion
  • synonyms:
  • Gata3<Citrine>,
  • Gata3<Citrine>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele