|  Help  |  About  |  Contact Us

Allele : Trp53bp1<em1Btlr> transformation related protein 53 binding protein 1; endonuclease-mediated mutation 1, Bruce Beutler

Primary Identifier  MGI:7549273 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Trp53bp1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  A knockout allele was created using an sgRNA (targeting TTTGACCAGAGTAGTAAAACAGG in exon 8) with CRISPR/Cas9 technology. This allele recapitulates the phenotype of the ENU-induced lentil mutation.
  • mutations:
  • Not Specified
  • synonyms:
  • Trp53bp1<->,
  • Trp53bp1<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories