|  Help  |  About  |  Contact Us

Allele : Atp6v1b2<em1Pcamp> ATPase, H+ transporting, lysosomal V1 subunit B2; endonuclease-mediated mutation 1, Philippe M Campeau

Primary Identifier  MGI:7567698 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Atp6v1b2
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 506 (CGA) in exon 14 was changed to a stop codon (TAA) (p.R506*) using an sgRNA (targeting GAGCGAATTTTACCCTCGAG) and an ssODN template with CRISPR/Cas9 technology. The mutation, which truncates the encoded peptide by 6 C-terminal amino acids, is the equivalent of the human NM_001693.3:c.1516C>T p.R506* mutation associated with autosomal dominant congenital deafness with onychodystrophy (DDOD) and deafness, onychodystrophy, osteodystrophy, mental retardation, and seizures syndromes (DOORS).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Atp6v1b2<emR506*>,
  • Atp6v1b2<emR506*>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele