|  Help  |  About  |  Contact Us

Allele : Hgsnat<em1Avps> heparan-alpha-glucosaminide N-acetyltransferase; endonuclease-mediated mutation 1, Alexey Pshezhetsky

Primary Identifier  MGI:7565614 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Hgsnat
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 304 (CCA) in exon 9 was changed to leucine (CTA) (c.911C>T, p.P304L) using an sgRNA (targeting TGGCCGACCTCGTCTTCCCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.P311L mutation associated with mucopolysaccharidosis IIIC (MPS IIIC) (Sanfilippo syndrome type C).
  • mutations:
  • Single point mutation
  • synonyms:
  • Hgsnat<P304L>,
  • Hgsnat<P304L>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

4 Publication categories

Trail: Allele