| Primary Identifier | MGI:7565614 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Hgsnat |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Proline codon 304 (CCA) in exon 9 was changed to leucine (CTA) (c.911C>T, p.P304L) using an sgRNA (targeting TGGCCGACCTCGTCTTCCCA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.P311L mutation associated with mucopolysaccharidosis IIIC (MPS IIIC) (Sanfilippo syndrome type C). |