| Primary Identifier | MGI:7628184 | Allele Type | Endonuclease-mediated |
| Gene | Camk2d | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Methionine codon 308 (ATG) in exon 12 was changed to valine (GTG) (p.M308V) using an sgRNA (equivalent to CGCCATCTTGACAACTATGCTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the calmodulin-binding domain of the encoded peptide, reduces calmodulin binding and kinase activity. |
