|  Help  |  About  |  Contact Us

Allele : Slco5a1<em1(IMPC)Tcp> solute carrier organic anion transporter family, member 5A1; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7565679 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slco5a1
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTTAGTGGTTCTAGAGCG targeting the 5' side and ACGGCCTCTACAAGTTAGGG targeting the 3' side of a critical region (ENSMUSE00001327733). This resulted in a 740-bp deletion of Chr1 from 13013818 to 13014557 with insertion of AGGA at the deletion junction (GRCm39). Absence of this exon from mRNA is predicted to introduce a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele