| Primary Identifier | MGI:7565728 | Allele Type | Endonuclease-mediated |
| Gene | Col1a1 | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNA with the spacer sequence GAGGTTCATGAGCCCTCAAA and an AAV repair template to insert a Bxb1 IMCE cassette comprised of a Bxb1 attP-GT site, a spacer sequence, and a Bxb1 attP-GA stie. This resulted in insertion of the Bxb1 IMCE cassette after Chr11:94844348 (GRCm39). This insertion should enable Bxb1 integrase-mediated cassette exchange with an appropriate vector and Bxb1 mRNA. |
