|  Help  |  About  |  Contact Us

Allele : Prdm14<em1Tcp> PR domain containing 14; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7565731 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag Gene  Prdm14
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele was generated at The Centre for Phenogenomics by injecting Cas9 protein and a synthetic crRNA with sequence CCGCAAAACUCAGCUUGCGA targeting the 5' side of exon ENSMUSE00000316434 and a single-strand oligonucleotide encoding a 3xHis tag. The 3xHis tag was inserted adjacent to the ATG codon of Prdm14 (c.3_4insCACCACCACCACCACCAC).
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele