|  Help  |  About  |  Contact Us

Allele : Npl<em1Avps> N-acetylneuraminate pyruvate lyase; endonuclease-mediated mutation 1, Alexey Pshezhetsky

Primary Identifier  MGI:7567785 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Npl
Strain of Origin  C57BL/6NHsd Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 63 (CGT) in exon 4 was changed to cysteine (TGT) (c.187C>T p.R63C) using an sgRNA (targeting TGAACGTCGCCAGGTCGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with sialic acid metabolism disorder leading to cardiomyopathy, mild skeletal myopathy, and sensorineural hearing loss. Transcripts are expressed from this allele but not proteins.
  • mutations:
  • Single point mutation
  • synonyms:
  • Npl<R63C>,
  • Npl<R63C>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele