|  Help  |  About  |  Contact Us

Allele : Sqstm1<em2Kmts> sequestosome 1; endonuclease-mediated mutation 2, Masaaki Komatsu

Primary Identifier  MGI:7570168 Allele Type  Endonuclease-mediated
Gene  Sqstm1 Strain of Origin  C57BL/6N
Is Recombinase  false Is Wild Type  false
molecularNote  Serine codon 351 (TCT) was changed to alanine (GCC) (p.S351A) using an sgRNA (targeting ACTGGAGTTCACCTGTAGAT) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks phosphorylation of the residue in the encoded peptide.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • p62<S351A>,
  • p62<S351A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele