| Primary Identifier | MGI:7568005 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Astl |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 274 (CGG) in exon 8 was changed to tryptophan (TGG) (c.820C>T, p.R274W) using an sgRNA (targeting GCAGACCCGGGTGATATCTGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with female infertility. |
