|  Help  |  About  |  Contact Us

Allele : Rgs17<em1(IMPC)J> regulator of G-protein signaling 17; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7574257 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rgs17
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GATAAATAACCGAAGCACTG and GCAAAACCTGGACCAGTAGA. This resulted in a 540 bp deletion of Chr10:5,841,189-5,841,728 (GRCm38/mm10) that removes exon ENSMUSE00000097978.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele