| Primary Identifier | MGI:7572842 | Allele Type | Endonuclease-mediated |
| Gene | Tfeb | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Cysteine codon 270 (TGC) in exon 4 was changed to serine (AGC) (p.C270S) using an sgRNA (targeting GCTTCTGAGTCAGGTCGGCA) and an ssODN template with CRISPR/Cas9 technology. The mutation blocks alkylation of the residue in the encoded peptide. |
