|  Help  |  About  |  Contact Us

Allele : P2ry10<em1(IMPC)J> purinergic receptor P2Y, G-protein coupled 10; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7608141 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  P2ry10
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ATATTTCAGTATGTTTGGCA and CGTCTCATGAGCAGGGAGAG. This resulted in a 988 bp internal deletion of ChrX:107,102,438-107,103,425 (GRCm38/mm10) and removes most of exon ENSMUSE00000383594 and has a 1 bp insertion at ChrX:107,102,459.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele