| Primary Identifier | MGI:7579075 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Ido2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 235 (CGG) in exon 8 was changed to tryptophan (TGG) (p.R235W) using sgRNAs (targeting CTTACCCAGAGAGGAAGATC, GTCATCCGGATCTTCCTCTC, and TCATCCGGATCTTCCTCTCT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of common human SNP rs10109853 (p.R248W) that renders the encoded peptide catalytically inactive. |
