| Primary Identifier | MGI:7639683 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified isoform(s) | Gene | Gja1 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Methionine codon 213 (ATG) was changed to leucine (TTA) (p.M213L) using a crRNA (targeting ATTCAGAGCGAGAGACACGA), tracrRNA and an ssODN template with CRISPR/Cas9 technology. The mutation, in a highly conserved region, only affects the generation of the shorter 20k peptide isoform that uses this ATG as the start codon. |
