| Primary Identifier | MGI:7580667 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Cdc20 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Asparagine codon 331 (AAC) in exon 7 was changed to lysine (AAG) (c.993C>G, p.N331K) using an sgRNA (targeting ATGATAACATTGTCAACGTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation (GRCh37:chr1:43826548C>G, NM_001255.2:c.993C>G, NP_001246.2:p.N331K) associated with familial malignant ovarian germ cell tumors (mOGCT). |
