| Primary Identifier | MGI:7587753 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Kcng1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with guide RNAs with the spacer sequences AGGTGGCGCTGACTTAACAT and GACACTAGGGACAACAACTG and two single-strand oligonucleotides encoding loxP sites. This resulted in loxP sites flanking the coding region; the 5' loxP site is upstream of the first coding exon (ENSMUSE00000639008) and the 3' loxP is 16bp 3' of the stop codon (GRCm38). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. |
