|  Help  |  About  |  Contact Us

Allele : Kcnt1<em1Lekk> potassium channel, subfamily T, member 1; endonuclease-mediated mutation 1, Leonard K Kaczmarek

Primary Identifier  MGI:7624374 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Kcnt1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 455 (CGA) in exon 15 was changed to histidine (CAC) (p.R455H) using an sgRNA (equivalent to CCAGACCATCCTTCGAGCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R474H mutation associated with epilepsy of infancy with migrating partial seizures of infancy (EIMFS) or malignant migrating partial seizures of infancy (MMPSI).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Slack<R455H>,
  • Kcnt1<R455H>,
  • Slack<R455H>,
  • Kcnt1<R455H>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele