Primary Identifier | MGI:7624374 | Allele Type | Endonuclease-mediated |
Attribute String | Humanized sequence | Gene | Kcnt1 |
Strain of Origin | C57BL/6J | Is Recombinase | false |
Is Wild Type | false |
molecularNote | Arginine codon 455 (CGA) in exon 15 was changed to histidine (CAC) (p.R455H) using an sgRNA (equivalent to CCAGACCATCCTTCGAGCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R474H mutation associated with epilepsy of infancy with migrating partial seizures of infancy (EIMFS) or malignant migrating partial seizures of infancy (MMPSI). |