| Primary Identifier | MGI:7610894 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence, Null/knockout | Gene | Ezh2 |
| Strain of Origin | C57BL/6J | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Arginine codon 679 (CGA) in exon 18 was changed to cysteine (TGT) (ENSMUSP00000080419:p.R679C) using an sgRNA (targeting GTGGTGGATGCAACCCGAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, in the SET domain of the encoded peptide, is the equivalent of the human c.2050C>T:p.R684C mutation associated with Weaver syndrome and results in a catalytically defective enzyme. Mouse embryonic fibroblasts (MEFs) produce normal levels of the mutant protein. |
